15.4 Ethics and Impacts of Biotechnology

Understand Key Concepts

24. The right to profit from a new genetic technology is protected by

    1. getting a copyright for the method.

    2. discovering a new gene.

    3. obtaining a patent.

    4. publishing its description in a journal.

25. Which of the following is most likely to be used in a court case to determine who the father of a particular child is?

    1. microarray analysis

    2. DNA fingerprinting

    3. gene therapy

    4. genetic engineering

26. Give an example of a disadvantage associated with patenting genes.

27. What is one argument used by critics of genetically modified foods?

Think Critically

28. Predict List three ways in which genetically engineered organisms might be used in the future.

29. Evaluate Your friend suggests that genetic engineering makes it possible for biologists to produce an organism with any combination of characteristics—an animal with the body of a frog and the wings of a bat, for example. Do you think this is a reasonable statement? Explain your answer.

Connecting Concepts

Use Science Graphics

Use the table below to answer question 30.

ddd

30. Apply Concepts Copy the following DNA sequence and write its complementary strand.

    ATGAGATCTACGGAATTCTCAAGCTTGAATCG

    Where will each restriction enzyme in the table cut the DNA strand?

Write About Science

31. Explanation Your local newspaper has published an editorial against using genetic modification. It asserts that GM is still too new, and traditional selective breeding can accomplish the same things as GM. Write a letter to the editor supporting or opposing this position.

32. Assess the Briefly describe the major steps involved in inserting a human gene into a bacterium.

Analyzing Data

Questions 33–35 refer to the diagram, which shows the results of a criminal laboratory test.

33. Infer Briefly describe the biotechnological methods that would have been used to produce the results shown at the right.

34. Compare and Contrast How are the bands from the jeans and the shirt similar? How are they different?

35. Draw Conclusions Based on the results shown, what conclusions might a prosecutor present to a jury during a criminal trial?

d

---

End ofPage 444

Table of Contents